p-ISSN: 2980-4302
e-ISSN: 2980-4310
Vol.
2 No. 9 September 2023
Fia Amalia, Madarina Wasissa, Fajar Budi Lestari, Siti Isrina
Oktavia Salasia
Universitas Gadjah Mada,
Indonesia
Email: [email protected]
Abstract
An
immune-mediated disease caused by a highly virulent Feline coronavirus (FCoV), Feline infectious peritonitis, is one of the most
challenging diseases in cats due to its difficulty in either diagnosis or
treatment. However, the recent investigation has offered some hope with the
discovery of adenosine nucleoside analog GS-441524, which has shown promising
results in terms of survival rates and clinical recoveries. This study
demonstrated the effectiveness of GS-441524 for FIP treatment. A-two-year-old
male mix breed was admitted to Satwakita Animal
Clinic, Yogyakarta and examined by responsible veterinarian. Abdominal effusion
was aseptically collected for further examination in Veterinary Medicine
Clinical Pathology Laboratory, Universitas Gadjah Mada. The analysis utilized RT-qPCR targeting 5’UTR
confirmed FCoV infection in the cat. The cat was
treated by daily administration of the nucleoside analog GS-441524 by
subcutaneously injection route for 40 days. The result of this treatment proves
that GS-441524 effectively cured FIP and eliminated FCoV
infection in the cat. In this case report, we showed that GS-441524 was
effective in this cat. Both clinical signs and FCoV
RNA were significantly reduced. The results highlight the promising potential
of GS-441524 for treating FIP that naturally occurs in cats.
Keywords: Case Report; FIP; FCoV;
RT-qPCR; GS-441524
INTRODUCTION
Feline infectious peritonitis (FIP) is caused by
the feline coronavirus (FCoV), which belongs to the
subspecies of alphacoronavirus-1. It is a contagious disease that affects
felids worldwide. Feline coronavirus infection is quite common in cats, often
causing mild symptoms like diarrhea. However, more
than 10% of FCoV infections develop into FIP
infections, leading to severe symptoms such as the appearance of ascites,
incoordination of the body, and eventually, death (Tasker,
2018). The mutation primarily affect the coronaviral
spike proteins, enabling the virus to replicate efficiently within macrophages
and spread within the cat (Pedersen,
2009). Studies have shown that FIP patients are more
likely to be purebred, young and sexually intact males (Rohrbach et
al., 2001). FIP possess significant challenges in both
diagnosis and treatment. Previous reports have outlined various methods to
detect FCoV infection, including molecular detection
using nested RT-PCR targeting 3’untranslated region (3’UTR) and RT-qPCR
targeting specific genes such as 5’UTR and N gene (Guan et
al., 2020; Sun et al., 2021; Wasissa et al., 2021).
The average survival time without effective
treatment is only 8 days after diagnosis, and most cats have to be euthanized
early due to their severe condition (Ritz et
al., 2007). Supportive care remains the primary approach for
treating FIP, temporarily reducing clinical signs and immune-modulator to
stimulate diseased patients’ imunity (Pedersen,
2014). Due to the lack of an effective treatment, FIP is
almost invariably fatal, with clinical mortality rate reaching as high as 90% (Rohrbach et
al., 2001). However, a recent investigation has shown
promising result in survival rates and clinical recoveries through the use of
adenosine nucleoside analog GS-441524 (Izes et
al., 2020). The previous report also showed the effectiveness
of GS-441524 in treating 32 cats naturally infected with FCoV
for 12 weeks period (Pedersen et
al., 2019). Dickinson et
al., (2020) reported that GS-441524 has the
potential to treat FIP with neurological presentation. The optimal dose range
for GS-441524 in cats is 5-10 mg/kg. Successful clinical recovery from FIP has
been documented in previous report. This case report is the first description
of the complete recovery of a cat examined through RT-qPCR, x-ray and hematology tests in Indonesia.
RESEARCH METHODS
Signalment and
History
A two-year- old male mix breed was investigated for further examination
of abdominal effusion and blood due to its high suspicion of feline infectious
peritonitis (FIP), suppoted by its consistent
history, clinical signs, and physical examination. The cat was admitted to Satwakita Animal Clinic, Yogyakarta and examined by a
responsible veterinarian. The cat had been displaying unusual behavior for the
last two weeks, followed by lethargy and abdominal distension, and tested
positive for Feline Infectious Peritonitis Antibody Rapid Test. According to
the owner’s information, the cat population consists of 17 cats with one
confirmed fatal case of FIP. All cats are kept indoors with limited access to
the surrounding environment and a complete vaccination record. In the clinic,
the cats presented with a reduced general condition, mild dehydration, pale
mucous membrane, a body temperature of 38,5°C, and a body weight of 3,2 kg
(Figure 1). The responsible veterinarian conducted Rivalta’s test, hematology
test and thoracoabdominal x-ray. The Rivalta’s test is positive, indicated the
presence of exudate-type abdominal effusion. Hematology results showed
lymphocytosis (Table 1). Thoracoabdominal x-ray was performed in lateral
recumbency and revealed radiopacity in the abdomen, indicating fluid
accumulation in the abdominal cavity (Figure 2). The data collected about the
patient and its publication was obtained with the consent of the responsible
veterinarian and cat’s owner.
1B 1A
Figure
1A. Picture of the cat on day 0 (day of first presentation in the clinic), 1B.
on day 40, six weeks of treatment.
Figure
2. Thoracoabdominal X-Ray Lateral View Showing Radiopacity Of The Abdomen
Indicating Fluid Accumulation
Table 1. Haematology results on day 0
and day 40 of treatment
|
Measurement |
Reference interval |
Result (day 0 treatment) |
Interpretation |
Result (day 40 treatment) |
Interpretation |
|
RBC (106/μl) |
4,6-10 |
7,21 |
Normal |
8,9 |
Normal |
|
Hb (g/dL) |
9,3-15,3 |
10,7 |
Normal |
12,7 |
Normal |
|
HCT (%) |
28-49 |
31,1 |
Normal |
33,7 |
Normal |
|
MCV (fL) |
39-52 |
43,2 |
Normal |
39,7 |
Normal |
|
MCH (pg) |
13-21 |
14,8 |
Normal |
14,2 |
Normal |
|
MCHC (g/dL) |
30-38 |
34,4 |
Normal |
37,6 |
Normal |
|
WBC (103/μl) |
5,5-19,5 |
16,9 |
Normal |
12,1 |
Normal |
|
Lymphocyte (103/μl) |
0,8-7 |
7,5 |
Lymphocytosis |
4,5 |
Normal |
|
Monocyte (103/μl) |
0,0-1,9 |
1 |
Normal |
0,9 |
Normal |
|
Neutrophil (103/μl) |
2,1-15 |
8,4 |
Normal |
6,7 |
Normal |
|
Eosinophil (103/μl) |
0-1,5 |
0,26 |
Normal |
0,19 |
Normal |
|
Basophil (103/μl) |
Rare |
0 |
Normal |
0 |
Normal |
|
PLT (103/μl) |
100-514 |
272 |
Normal |
419 |
Normal |
*Reference interval
(Weiss and Wardrop, 2010)
Improvement of
Clinical Signs, Thoracoabdominal X-ray, and Laboratory Abnormalities during
Treatment.
To gain definitive diagnosis, abdominal effusion was aseptically
collected for cytology analysis and molecular detection in Veterinary Medicine
Clinical Pathology Laboratory, Universitas Gadjah Mada. Cytology analysis of abdominal effusion revealed
cloudy exudate contained macrophages and neutrophils with eosinophilic
proteinaceous background (Figure 3). Definitive diagnosis of FIP was based on
consistent history, clinical signs, laboratory abnormalities, and molecular
detection of FCoV using reverse transcriptase
quantitative polymerase chain reaction (RT-qPCR) targeting 5’ untranslated
region (5’UTR) and positive if the cycle threshold was <35 and melt curve
was 80 (
Figure
3. Cytology Analysis of Abdominal Effusion Contained Macrophages (Black Arrow)
And Neutrophils (White Arrow) With An Eosinophilic Proteinaceous Background
Table 2. The Primer That Were
Used In This Investigation
|
Target |
Primer |
Nucleotide |
Reference |
|
5’UTR |
FCoV-SYBR-F |
GAGGAATTACGGGTCATC |
Sun et al. (2021) |
|
FCoV-SYBR-R |
CATTGCCAAATCAAATCTAAAC |
The cat was treated by daily administration of the nucleoside analog
GS-441524 by subcutaneously injection route, for 40 days. Due to abdominal
effusion manifestation, a dose of supposedly 6 mg/kg (according to the
manufacturer) was chosen. From the fourth day of treatment onward, the cat’s
appetite improved and it started to gain weight. Six weeks of treatment (day
40), the cat had reached a weight of 3,8 kg, and a body temperature of 38,6°C
(Figure 1B). Hematology results were found at normal levels (Table 1). A
thoracoabdominal x-ray performed in lateral recumbency showed a decrease in
fluid accumulation in the abdominal cavity (Figure 4). Molecular analysis
showed an increase of cycle threshold after 40 days of treatment (Table 3).
Table 3. The results of
RT-qPCR before and day 40 treatment
|
|
Cycle threshold |
|
Day 0 (before treatment) |
26,91 |
|
Day 40 of treatment |
29,06 |
Figure 4. Thoracoabdominal X-Ray Was
Performed In Lateral Recumbency Showed A Decrease Of The Accumulation Fluid In
The Abdominal Cavity
RESULT AND DISCUSSION
This case report describes a cat
that participated in investigating the efficacy of parenteral antiviral drug to
treat FIP. The cat describe here was included in the study as it fulfilled the
inclusion criteria of (1) clinical symptoms that appeared lead to FIP, (2)
positive test result for FCoV molecular diagnosis
(RT-qPCR), (3) there’s one fatal case FIP confirm in its population. After
initial presentation with apathy, lack of appetite and abdominal effusion, the
cat showed a swift response to treatment, with rapid improvement of clinical
and laboratory parameters leading to full. The cat was treated with 6 mg/kg of
the nucleoside analog GS-441524 by subcutaneously injection route. The
considerations for using GS-441524 in
this case are (1) GS-441524 has been shown to be effective in curing FIP in
some cases, as in study conducted by Krentz et al., (2022), (2) investigation in feline
infectious peritonitis cat treated with GS-441524 has never been done in
Indonesia, that it can be a good information for veterinarians, (3) cat’s owner
support this investigation.
GS-441524 a 1’cyano-substituted
adenine C-nucleoside ribose analogue is a small molecule that exhibits potent antiviral
activity against a number of RNA viruses, including the zoonotic severe acute
respiratory syndrome (SARS) coronavirus (Cho et al., 2012). GS-441524 is the targeted
antiviral drug to be evaluated for the treatment of cats with FIP in the past
two to three years. This drug inhibited viral replication in two very different
manners, either by terminating viral RNA transcription or blocking viral
polyprotein cleavage (Murphy et al., 2018). The main abnormality of FIP in the
cat presented in this case report was abdominal effusion. The appearance of
abdominal effusion is one of the clinical symptoms in wet FIP cases. Wet FIP
cases accounts for 80% of all FIP cases, so this tendency is one of the
characteristics of FIP. The classical effusion of wet FIP results from mainly
from acute damage to the vessel walls and leakage of plasma into the
interstitial spaces and eventually into body cavities. This can occur because
activated monocytes will spread the virus and cause vasculitis. Monocytes will
migrate and attach to blood vessels and cause the formation of focal
infiltrates in the blood vessel walls (Kipar et al., 2005).
GS-441524 treatment over a total
period of 40 days was remarkably safe. No longterm abonormalities were observed in viral RNA level,
thoracoabdominal x-ray and haematology test. Decrease
of viral RNA level is indicated by cycle threshold which increase after 40 days
of treatment. Similarly with Pedersen et al., (2019) that viral RNA level decreased by
2-5 days after GS-441524 treatment. Abdominal effusion rapidly decreased
starting around 14 days post-treatment, and rapidly disappear around six weeks.
Cat presented with elevated lymphocyte counts, which droped
to average level within six
weeks of treatment. Immediate pain reactions in injection site
were manifested by vocalization, occasional growling, and postular
changes lasting for 40-60 seconds, but there is no
scars in injection sites.
CONCLUSION
This is the first case report describing clinical and
molecular investigation in a cat cured of FIP. In this case report, we showed
that GS-441524 was effective in this cat. Both clinical signs and FCoV RNA were significantly reduced. GS-441524 holds great
promise in the treatment of naturally occurring FIP. This case report will be
essential for future efforts in comersialization of
this drug in Indonesia.
BIBLIOGRAPHY
Cho, A., Saunders, O. L., Butler, T.,
Zhang, L., Xu, J., Vela, J. E., Feng, J. Y., Ray, A. S., & Kim, C. U.
(2012). Synthesis And Antiviral Activity Of A Series Of 1′-Substituted 4-Aza-7,9-Dideazaadenosine
C-Nucleosides. Bioorganic & Medicinal Chemistry Letters, 22(8), 2705–2707.
Https://Doi.Org/10.1016/J.Bmcl.2012.02.105
Dickinson,
P. J., Bannasch, M., Thomasy, S. M., Murthy, V. D., Vernau, K. M., Liepnieks, M.,
Montgomery, E., Knickelbein, K. E., Murphy, B., & Pedersen, N. C. (2020). Antiviral
Treatment Using The Adenosine Nucleoside Analogue GS ‐441524 In Cats With Clinically
Diagnosed Neurological Feline Infectious Peritonitis. Journal Of Veterinary
Internal Medicine, 34(4), 1587–1593. Https://Doi.Org/10.1111/Jvim.15780
Guan, X.,
Li, H., Han, M., Jia, S., Feng, B., Gao, X., Wang, Z., Jiang, Y., Cui, W., Wang,
L., & Xu, Y. (2020). Epidemiological Investigation Of Feline Infectious
Peritonitis In Cats Living In Harbin, Northeast China From 2017 To 2019 Using A
Combination Of An Evagreen-Based Real-Time RT-PCR And Serum Chemistry Assays. Molecular
And Cellular Probes, 49, 101495. Https://Doi.Org/10.1016/J.Mcp.2019.101495
Izes, A.
M., Yu, J., Norris, J. M., & Govendir, M. (2020). Current Status On
Treatment Options For Feline Infectious Peritonitis And SARS-Cov-2 Positive
Cats. Veterinary Quarterly, 40(1), 322–330.
Https://Doi.Org/10.1080/01652176.2020.1845917
Kipar,
A., May, H., Menger, S., Weber, M., Leukert, W., & Reinacher, M. (2005). Morphologic
Features And Development Of Granulomatous Vasculitis In Feline Infectious
Peritonitis. Veterinary Pathology, 42(3), 321–330.
Https://Doi.Org/10.1354/Vp.42-3-321
Krentz,
D., Zwicklbauer, K., Felten, S., Bergmann, M., Dorsch, R., Hofmann-Lehmann, R.,
Meli, M. L., Spiri, A. M., Von Both, U., Alberer, M., Hönl, A., Matiasek, K.,
& Hartmann, K. (2022). Clinical Follow-Up And Postmortem Findings In A Cat
That Was Cured Of Feline Infectious Peritonitis With An Oral Antiviral Drug Containing
GS-441524. Viruses, 14(9), 2040. Https://Doi.Org/10.3390/V14092040
Murphy,
B. G., Perron, M., Murakami, E., Bauer, K., Park, Y., Eckstrand, C., Liepnieks,
M., & Pedersen, N. C. (2018). The Nucleoside Analog GS-441524 Strongly
Inhibits Feline Infectious Peritonitis (FIP) Virus In Tissue Culture And
Experimental Cat Infection Studies. Veterinary Microbiology, 219, 226–233.
Https://Doi.Org/10.1016/J.Vetmic.2018.04.026
Pedersen,
N. C. (2009). A Review Of Feline Infectious Peritonitis Virus Infection:
1963–2008. Journal Of Feline Medicine And Surgery, 11(4), 225–258.
Https://Doi.Org/10.1016/J.Jfms.2008.09.008
Pedersen,
N. C. (2014). An Update On Feline Infectious Peritonitis: Diagnostics And
Therapeutics. The Veterinary Journal, 201(2), 133–141. Https://Doi.Org/10.1016/J.Tvjl.2014.04.016
Pedersen,
N. C., Perron, M., Bannasch, M., Montgomery, E., Murakami, E., Liepnieks, M.,
& Liu, H. (2019). Efficacy And Safety Of The Nucleoside Analog GS-441524
For Treatment Of Cats With Naturally Occurring Feline Infectious Peritonitis. Journal
Of Feline Medicine And Surgery, 21(4), 271–281. Https://Doi.Org/10.1177/1098612X19825701
Ritz, S.,
Egberink, H., & Hartmann, K. (N.D.). Effect Of Feline Interferon-Omega On
The Survival Time And Quality Of Life Of Cats With Feline Infectious
Peritonitis.
Rohrbach,
B. W., Legendre, A. M., Baldwin, C. A., Lein, D. H., Reed, W. M., & Wilson,
R. B. (2001). Epidemiology Of Feline Infectious Peritonitis Among Cats Examined
At Veterinary Medical Teaching Hospitals. Journal Of The American Veterinary
Medical Association, 218(7), 1111–1115.
Https://Doi.Org/10.2460/Javma.2001.218.1111
Sun, L.,
Xu, Z., Wu, J., Cui, Y., Guo, X., Xu, F., Li, Y., & Wang, Y. (2021). A Duplex
SYBR Green I-Based Real-Time Polymerase Chain Reaction Assay For Concurrent
Detection Of Feline Parvovirus And Feline Coronavirus. Journal Of Virological
Methods, 298, 114294. Https://Doi.Org/10.1016/J.Jviromet.2021.114294
Tasker,
S. (N.D.). Diagnosis Of Feline Infectious Peritonitis: Update On Evidence
Supporting Available Tests. R E V I E W.
Wasissa,
M., Lestari, F. B., & Salasia, S. I. O. (2021). Streptococcus Equi Subsp. Zooepidemicus
Finding In Confirmed Feline Infectious Peritonitis Cat Patient. Heliyon, 7(6),
E07268. Https://Doi.Org/10.1016/J.Heliyon.2021.E07268
Copyright holders:
Fia Amalia, Madarina Wasissa, Fajar Budi Lestari, Siti Isrina
Oktavia Salasia (2023)
First publication right:
AJHS - Asian Journal of
Healthy and Science
This article is licensed under a Creative
Commons Attribution-ShareAlike 4.0 International